Total RNA was extracted and reverse transcribed into cDNA, which was then used for amplification of CDK8 and

β-catenin. The real time PCR conditions consisted of 1 cycle at 94°C for 10 min followed by 40 cycles at 94°C for 30 s, at 55°C for 30 s, and at 72°C for 30 s. GAPDH was employed as an internal standard. The primer sequences were as follows: 5′-GAGCGGGTCGAGGACCTGTTTGAAT-3′ (forward) and 5′-ACATGCCGACATAGAGATCCCAGTTCCTTC-3′ (reverse) for CDK8; 5′-TGCCAAGTGGGTGGTATAGAG-3′ (forward) and 5′-TGGGATGGTGGGTGTAAGAG-3′ (reverse) for β-catenin; 5′AGGGGCCATCCACAGTCTTC3′ (forward) and 5′ AGAAGGCTGGGGCTCATTTG 3 (reverse) for GAPDH. The 2 -ΔΔCT method was applied to analyze the relative changes in selleck chemicals llc gene expression. Western blot analysis As described previously [14], following 72 h of transfection, total protein was extracted from HCT116 cells and subjected to SDS-PAGE. Protein concentrations were transferred onto PVDF membrane, then membranes were blocked and incubated with rabbit anti-human CDK8 (1:1000) or β-catenin antibody (1:1000) Combretastatin A4 ic50 at 4°C overnight. After 3 washes with TBS-T solution for 10 min, the membranes underwent hybridization with a goat anti-rabbit IgG secondary antibody (1:1000) at 37°C for 1 h. After

further washing, CDK8 and β-catenin levels were visualized using an ECL chemiluminescence kit. Immunohistochemistry The protein expression of CDK8 and β-catenin

in 47 tumor tissues and adjacent normal tissues were detected by IHC. Samples were fixed in 10% neutral formaldehyde, embedded in paraffin, and sliced. Briefly, the paraffin-embedded tissues were serially cut into 4 μm sections, dewaxed, and rehydrated. Sections were then Selleck ZD1839 blocked with peroxide and non-immune animal serum and incubated sequentially with rat anti-human CDK8 and β-catenin (1:1000), and biotin-labeled goat anti-rabbit IgG (1:1000). Finally, the sections were stained with DBA, counterstained with hematoxylin, dehydrated, cleared in xylene, and fixed. Histological assessment was performed as described previously [15]. Immunostaining was independently examined by two clinical pathologists who were unaware of the patient outcome. Five high-power fields (400 × magnification) were randomly counted for each section. The brown staining on the cytoplasm was read as positive reactivity for CDK8 and β-catenin. The presence of brown colored granules on the cytoplasm was taken as a positive signal, and was divided by color BI 10773 datasheet intensity into not colored, light yellow, brown, tan and is recorded as 0, 1, 2, 3, respectively. We also choose five high-power fields from each slice and score them. Positive cell rate of < 25% was a score of 1, positive cell rate of 25~50% was a score of 2, positive cell rate of 51~75% was a score of 3, positive cell rate of > 75% was a score of 4.