The AE PCC quality indicators are the first of their kind to address this measurement challenge. Twelve NHs tested the PCC toolkit and found it easy to implement in short and long stay

settings. All pilot sites stated that they would participate in the AE national roll out of the PCC indicators and they would recommend the toolkit to others. Pilot sites highlighted several strengths of the toolkit. First, the interviews are readily acceptable to consumers. Sites reported that the questions were easy this website for residents to understand and that residents were able to identify what was important to them. Families were impressed with the NH’s implicit commitment to quality of care, as evidenced by asking questions about a loved one’s preferences. Staff members, too, received the toolkit well. Social workers, recreation staff, nurses, and direct care workers were able to interview residents and enter data into the Excel spreadsheet. Several sites commented on the value of involving CNAs in the preference interview process, especially

as it related to personal care questions. For the pilot study, sites were given several different options for the choice of interviewer for the preference and satisfaction portions of the interview. A majority opted to have the same person conduct both components, which may have led to some bias. In the future, it would be prudent to have different individuals conduct each part of the interview; as noted Volasertib research buy in the AE PCC implementation guide, residents are more likely to give forthright answers if the preference satisfaction interviewer is not directly involved in the

resident’s care.23 The literature suggests that the choice of interviewer is an important one. A recent study24 found that Veterans Administration NH residents were most comfortable discussing the quality of their care with licensed nursing staff, followed by physicians, family/friends, social workers and administrators. Residents were least comfortable 4��8C talking with nurse aides. The authors suggest that residents may hesitate to tell a direct caregiver that they are dissatisfied with their care, and they may see licensed nurses as having the greatest influence on quality. The study recommends that licensed nurses and primary care professionals should routinely ask residents about their quality of care, an option that is possible with the AE PCC toolkit. Pilot communities reported the PCC toolkit’s graphic displays and outputs provided a useful visual resource to help communities know “what we are doing well and what we need to keep working on.

Large bivalves (like Unio, Anodonta and Dreissena) may accumulate a notable quantity of cyanotoxins in the field, but seem to be rather insensitive to them ( Bij de Vaate et al., 2010, Ibelings et al., 2005 and Watanabe et al., 1996). The bigger and older check details mussels could have experienced

contact with toxic cyanobacterial blooms more than once or for a longer period during their life. Thus, there is a probability to find some residual concentrations of cyanotoxins in mollusk tissues a certain time after exposure due to incomplete depuration ( Mazur-Marzec et al., 2006). Our results, as well as results of other studies ( Amorim and Vasconcelos, 1999 and Yokoyama and Park, 2003), confirm the long-lasting persistence of microcystin in environment and filter-feeding organisms. Even devoid of cyanotoxins in water, a certain amount of toxins have been detected both in sediment samples and zebra mussel tissues two years after exposure to the toxic bloom ( Figure 2 and Figure 3). The increased stability of the toxin might be a result

from slower biodegradation at low water temperatures or/and from the binding of hepatoxins to sediment particles ( Mazur-Marzec et al., 2006). Also, it is known that in temperate waters, vegetative filaments of potentially toxic cyanobacteria may form benthic overwintering populations ( Gérard et al., 2009). As we did find considerable concentrations of microcystins in the bottom sediments at all sites sampled in 2008 ( Fig. 4), when no toxic bloom was detected, it is possible to hypothesize that microcystins Stem Cell Compound Library clinical trial absorbed to the sediment particles could have persisted from previous Cell press years. That is consistent with a number of studies ( Chen et al., 2005, Lahti et al., 1997, Latour et al., 2007 and Zakaria et al., 2007) stating that microcystins and their degradation products could

persist in bottom sediments for more than a decade ( Pawlik-Skowrońska et al., 2010). Therefore, considering the resuspension as one of the most common phenomena in the shallow Curonian lagoon ( Pilkaitytė and Razinkovas, 2006), residuals of toxic compounds could be uptake by mussels with resuspended sediment particles not only in 2006 but also in 2007 and 2008 when no toxic blooms were detected. Resuspension also could explain the presence of comparatively high microcystin concentrations in mollusks well after the toxic blooms the same year ( Fig. 5) as zebra mussels is known for quite high depuration rates ( Dionisio Pires et al., 2004). On the other hand, toxic cyanobacteria could have be also present but not detected in the water column in 2007 and 2008, due to low density or great spatio-temporal variability, despite the obvious mechanism of secondary contamination. Due to their feeding behaviour, generally wide distribution and abundance, close association with benthic sediments and relatively sedentary nature, zebra mussels are considered as a proper indicator of water contamination (Lefcort et al., 2002 and Salanki, 2000).

The venom toxicity was higher for Asian and African species, and for arboreal ones such as Heteroscodra, Stromatopelma, and Poecilotheria species. Among the 20 South American species, 12 of them, including Grammostola spatulata and Acanthoscurria sp., showed higher learn more venom toxicity leading to death in less than 30 min ( Escoubas and Rash, 2004). The LD50 value of A. paulensis venom, when injected intraperitoneally in 30 g mice, was 25.4 ± 2.4 mg/kg, with a clear dose-dependence, and

death occurred in approximately 2 h. It has been reported for Acanthoscurria musculosa a LD50 of 7.5 mg/kg when intravenously inject into mice ( Bucherl, 1971). The LD50 calculated after intravenous injection of the venom of the tarantula Stromatopelma griseipes was 8.1 and 9.5 mg/kg for young female and adult male spiders, respectively ( Célérier et al., 1993). Quantitative comparison with previous studies is challenging,

since the toxicity IDH inhibitor varies with the route of venom administration and the time considered. The A. paulensis venom seems to be less toxic than other tarantula venoms ( Bucherl, 1971; Célérier et al., 1993). However, it is important to consider the administration route used to determine the LD50 value. This venom toxicity might be higher, with maybe different observed symptoms, if it was administered by intravenous or intracerebroventricular route, and not by intraperitoneal route, Fludarabine as it was done. Even so, considering the LD50 obtained for A. paulensis venom

and the absence of serious accidents reported with its bite, it is assumed that this spider is not of clinical importance for humans. Even though the trials using mice and other nonhuman animals are essential tools for toxicity studies, differential toxicity in mammals can lead to incorrect extrapolations. The venom of Australian Atrax robustus is highly toxic and potentially lethal to humans, but has almost no effect in most non-primates, including rodents and domestic animals such as dogs ( Sutherland and Tibballs, 2001). In contrast, Phlogiellus spp. and Selenocosmia spp. venoms are fatal to dogs, but have little effect in humans ( Isbister et al., 2003). Among the symptoms described for Theraphosidae spider bites the most common is the severe pain. The intradermal injection in mice was used to investigate the nociceptive response induced by A. paulensis venom effects on pain. In the formalin test, the first phase is thought to result from direct activation of primary afferent sensory neurons, whereas the second phase has been proposed to reflect the combined effects of afferent input and central sensitization in the dorsal horn (for review see Le Bars et al., 2001).

A total of forty-three participants responded, however three questionnaires were incomplete. The sample included qualified physiotherapists (n = 31) and students (n = 12), of whom 18 (42%) were male and 25 (58%) female. The number of years experience in musculoskeletal physiotherapy ranged from 2 months to 29 years (mean: 10 years 10 months, median: 10 years 2 months) and the number of years qualified ranged from 1 year 3 months–37 years (mean: 13 years 10 months, median: 12 years 2 months). The majority of respondents reported including the following topics in their clinical encounter before raising the KCQ: i) a general

greeting (n = 39); ii) an introduction of their name (n = 38) and role (n = 31); iii) an explanation of what would be involved in the consultation (n = 31); iv) confirmation of referrer AZD8055 purchase details (n = 28); and v) a check of the patient’s personal details (n = 32), and preferred name (n = 33). Additionally, 16% (n = 7) reported mentioning parking and directions, and 30%

(n = 13) the weather. The preferred phrasing of the KCQ in an initial clinical encounter was “Do you this website want to just tell me a little bit about (your ‘problem presentation’) first of all?” (score: 83). Preferences for the KCQs are summarised in Table 1. When clinicians were asked for their own preference for opening a clinical encounter (i.e. not from the audio-recordings), a shared theme that arose was to explicitly ask about the patients’ presenting problems and why they had come to physiotherapy in their own words. The themes participants identified as ‘missing’ from

the questionnaire included: a check to see if patients had seen a physiotherapist before; establishing whether patients understood L-gulonolactone oxidase why they had been referred; and their understanding of the role of physiotherapy. In the follow-up consultations, clinicians reported greeting the patient (n = 38), giving a summary of the previous clinical encounters findings (n = 20), and explaining what would be involved in the follow-up consultation (n = 20) prior to asking them about their problem presentation. Additionally, 14% (n = 6) of respondents reported mentioning parking, 5% (n = 2) directions and 37% (n = 16) weather, before the KCQ. An additional topic respondents deemed important to bring up was to check how the patient felt after their initial physiotherapy session. The preferred phrasing of the KCQ by physiotherapists in a follow-up clinical encounter was “How have you been since I last saw you?” (score: 158). Preferences of KCQs in the follow-up encounters are summarised in Table 2. When asked if they had any other preferred ways of opening the encounters, a theme emerged of asking directly about the patient’s symptoms. From the 42 audio-recorded initial consultations, 19% (n = 8) of the KCQs were open, 17% (n = 7) were open-focused and 64% (n = 27) were closed. Open questions elicited on average a 22.

The percentage of splenic NK cell (CD3− NK1.1+) recovery after the isolation procedure was evaluated using splenic cells from five mice that were processed with PE-labeled anti-CD3 (clone 17A2) and PerCP-Cy5.5-labeled anti-NK1.1 (clone PK136) antibodies (BD Pharmingen) in a FACSCalibur™ flow cytometer equipped with Cell Quest Pro® software (Becton Dickinson [BD] Immunocytometry System) and analyzed with FlowJo 7.2.6® software (Tree Star Inc, Ashland, KY) as demonstrated in Fig. 1A and B. The percentages

of splenic NK cells presented in Fig. 1A and B represent the mean obtained from five mice. Isolated splenic NK cells from Co (n = 5), Pt (n = 5), PtSe (n = 5) and Se (n = 5) groups treated daily by gavage for 14 days were used. Total RNA was isolated with the RNAspin Mini RNA see more Isolation Kit and RNA integrity was assessed using a 2100 Bioanalyzer (Agilent). Double-stranded cDNA was synthesized from 200 ng total RNA using the Agilent One-Color Spike-Mix as positive controls and cDNA Master Mix (Agilent). cRNA was transcribed

from the cDNA and labeled using the Quick Amp Labeling Kit (Agilent). Cyanine 3-labeled and amplified cRNA was purified using RNAspin mini columns (GE Healthcare) and the Cy3 concentration was evaluated using a NanoVue™ Plus spectrophotometer (GE Healthcare). Cy3-labeled cRNA (1.65 μg) was fragmented and hybridized to Whole Mouse Genome 4 × 44k arrays (Agilent) at 10 rpm/17 h at 65 °C. Hybridized arrays were washed with the Gene Expression Wash Buffer Kit (Agilent) and scanned using an Agilent Microarray scanner. Data were extracted using the Agilent Feature Extraction 9.5.3.1 software. Five slides with four arrays each (4 × 44k) were GSK-3 phosphorylation used, and one sample from each group (Co, Pt, PtSe and Se) was loaded onto each slide giving a total of five arrays per group. Isolated splenic NK cells from Co (n = 3), Pt (n = 3), PtSe (n = 4) and Se (n = 3) groups treated daily by gavage for 14 days were used. Total RNA was extracted using an RNAspin Mini RNA Isolation Kit, following

manufacturer’s instructions and RNA 17-DMAG (Alvespimycin) HCl integrity was assessed using a 2100 Bioanalyzer (Agilent). Real-time quantitative PCR of the Mt2 gene and the reference 18s gene was performed using the Verso™ 1-Step QRT-PCR Rox Kit (Thermo Scientific), following manufacturer’s instructions, on the ABI Prism 7500 thermocycler (Applied Biosystems). Primers were designed using Primer-3 software ( Rozen and Skaletsky, 2000) and were run in BLAST ( Altschul et al., 1990) to verify the absence of local alignments with DNA or other RNA transcripts. The following primers were used: Mt2_F (CCGATCTCTCGTCGATCTTC), Mt2_R (GCAGGAAGTACATTTGCATTG), 18s_F (CCTGCGGCTTAATTTGACTC) and 18s_R (CTGTCAATCCTGTCCGTGTC). Finally, relative gene expression data were processed and analyzed according to Livak’s method ( Livak and Schmittgen, 2001). Splenic cell suspensions were prepared from six untreated mice, and non-adherent cells were separated as outlined above.

The relative expression of the gene TaWAK5 was calculated with the 2− ΔΔCT method [34], where the wheat TaActin gene was used as the internal reference. The sequences of primers used are listed in Table S1. Microarray analysis is Transferase inhibitor a frequently used molecular genetic technique for the identification of target genes that are expressed differentially between different plant tissue samples or the same samples under

different treatments. In this study, we used Agilent wheat microarrays to identify WAK genes that were differentially expressed between the resistant wheat genotype CI12633 and susceptible wheat cultivar Wenmai 6 following infection with R. cerealis. Based on differentially-expressed gene analysis, a wheat cDNA fragment CA642360 had a 30-fold increase in transcript level in the resistant CI12633 as compared with the susceptible Wenmai GPCR Compound Library order 6 at 21 dpi. BLAST searching against the GenBank database showed that this gene was homologous to the genes encoding WAKs in plants. As four WAK genes, TaWAK1, TaWAK2, TaWAK3, and TaWAK4, were isolated from wheat in a previous study [12],

hereafter, this novel wheat WAK gene induced by R. cerealisis designated as TaWAK5. To further investigate the involvement of TaWAK5 in wheat responses against R. cerealis, qRT-PCR was used to analyze the transcript profile of TaWAK5 in wheat infected with the fungal pathogen R. cerealis. The analysis over a 21-day pathogen inoculation time-series showed that TaWAK5 was induced by R. cerealis infection in both the resistant CI12633 and in the susceptible Wenmai 6, whereas the induction degree was higher in CI12633 as compared to Wenmai 6 ( Fig. 1-A). Verteporfin purchase The expression level of TaWAK5 in CI12633 was about 15 times higher than the level in Wenmai 6 at 21 dpi, consistent

with the result of the microarray analysis and with the level of resistance displayed by the genotypes. Following R. cerealis infection, TaWAK5 transcripts in the resistant CI12633 were induced at 4 dpi, reached a first peak at 10 dpi (about 24-fold increase over 0 dpi), decreased at 14 dpi, and reached a second peak at 21 dpi (about 33-fold increase over 0 dpi). Meanwhile, the expression of TaWAK5 in different tissues of the R. cerealis-inoculated CI12633 was assessed using qRT-PCR ( Fig. 1-B). At 4 dpi, the TaWAK5 gene was expressed most highly in the roots (10-fold over in the stems) than in the sheaths and leaves. The lowest expression was found in the stems. The expression level of TaWAK5 in the sheaths was 7 times higher than that in the stems. At 45 dpi, the transcriptional level of TaWAK5 was the highest in the root samples and lowest in the young spike tissue, with 107 times higher expression level in the former root tissue. The expression level of TaWAK5 was elevated 2-fold in stems and 1.99-fold in leaves compared with the young spike. A more detailed analysis of the expression patterns of TaWAK5 was carried out in R.

76% of the phenotypic variation. Six gene clusters were detected for the 56 additive and epistatic QTL identified in this study, and were located on chromosomes 2D, 4B, 4D, 5A, 5B, 5D and 7B (Table 4 and Fig. 1). These selleck kinase inhibitor QTL clusters suggested polytrophic effects conferred by

some loci. Four QTL (QPH.caas-2D, QSC.caas-2D, QSL.caas-2D and QFHB.caas-2D) were located in the region Xwmc111–Xwmc112 on chromosome 2D where Rht8 was located. The positive values for PH and SL and negative values for SC and FHB suggested that the allelic effects from YZ1 in this QTL cluster were for increasing PH, and SL, but decreasing SC and FHB (increasing FHB resistance) or alternately that the allele from NX188 decreased PH and SL but increased SC and FHB. Four QTL (QGNS.caas-4B, QPH.caas-4B, QTGW.caas-4B and QFHB.caas-4B) were located in the region Xgwm0925–Xgwm0898 on chromosome 4B, co-locating with dwarfing gene Rht-B1. The positive values for PH and TGW, and negative values for FHB and

GNS suggested that alleles from YZ1 increased PH and TGW but reduced FHB resistance and GNS, or alternatively, the allele from NX188 with the effect of reducing PH and TGW but increasing FHB resistance and GNS. Three QTL (QPH.caas-4D, Atezolizumab QTGW.caas-4D and QFHB.caas-4D) were mapped in the region between markers Xpsp3007 and DFMR2 on chromosome 4D, the position of dwarfing gene, Rht-D1. The allele from YZ1 for the QTL cluster reduced PH, TGW and FHB resistance or alternatively the allele from NX188 increased PH, TGW and FHB resistance. Three QTL (QGNS.caas-5A, QSC.caas-5A and QSPI.caas-5A) were in the region Xgwm304–Xbarc56 on chromosome 5A. The YZ1 allele in this QTL cluster had the effect of increasing GNS and SPI and reducing

SC. Five QTL (QGNS.caas-5D, QPH.caas-5D, QSPI.caas-5D, QSL.caas-5D and QFHB.caas-5D) were mapped between Xgwm292 and Xgwm269 Methane monooxygenase on chromosome 5D, the location of vernalization gene Vrn-D1. The NX188 allele at this locus had a large effect on simultaneously increasing FHB resistance, GNS, SL, and SPN, and with low interaction with PH. Finally, four QTL (two with additive and two epistatic effects) were mapped in the TaCK7B–Xwmc276 region on chromosome 7B. TaCK7B is a cytokinin-oxidase/dehydrogenase gene controlling cytokinin levels in plant tissues [21]. MAS was carried out to select elite lines with high FHB resistance and good agronomic traits. Among them, FHB was treated as first priority. Six elite lines were selected based on this criterion (Table 5). All had better agronomic traits (Table 6) than the others. No significant differences were detected between the observed and predicted values for all seven traits with SPI in the 2004–2005 cropping season (P = 0.05) as the only exception. These results indicated a high efficiency of MAS in this study ( Table 5). For example, for FHB resistance, RIL-151 and RIL-164 carried all five resistance alleles, and showed the best FHB resistance.

akashiwo cells and in cell-free suspensions of blooms, but not in the cell-free medium of batch cultures. This may be explained by the

hypothesis that the haemolytic agents of raphidophytes are located in certain intracellular compartments, and leakage or release of these haemolytic agents from algal cells occurs Protein Tyrosine Kinase inhibitor only as a consequence of cell damage and does not take place during normal growth ( Kuroda et al., 2005 and Ling and Trick, 2010). This hypothesis is also supported by our results, indicating that the haemolytic activity of a cell-free suspension of bloom samples increased with decreasing Heterosigma cell numbers in the bloom, reaching its maximum when the bloom began to collapse. Given that a concentration of 3 μg saponin ml− 1 induced 50% haemolysis in the present selleck chemicals llc study (data not shown), the haemolytic activities of Saudi H. akashiwo blooms (3.64–4.92 × 104 cells ml− 1)

and batch cultures (5.97–6.03 × 104 cells ml− 1) are in accordance with the ranges reported for raphidophytes in other studies. Ling & Trick (2010) found that 50% haemolysis was observed for sonicated extracts of H. akashiwo at concentrations of 1.5–6 × 104 cells ml− 1 and 2.5 μg ml− 1 saponin. For Fibrocapsa japonica, the EC50 values ranged between 1.7–6.3 × 104 cells ml− 1 ( de Boer et al. 2004) and 0.4–1.9 × 104 cells ml− 1 ( de Boer et al. 2009) at EC50 of 4.5 μg ml− 1 saponin as a reference. The present study also revealed a higher haemolytic activity in bloom extracts than in batch culture extracts of H. akashiwo. This finding could be due to the exposure of the bloom to many stresses such as salinity and nutrient limitation in the natural oxyclozanide environment, which induces the algal cells to produce more toxins, as reported in previous studies (Ono et al. 2000, Haque and Onoue, 2002 and de Boer et al., 2004). This is in contrast to the cells of batch cultures, which mostly grow under optimal conditions. Furthermore, the haemolytic activity, particularly of methanol extracts, differed significantly among bloom samples collected at different periods from Saudi coastal waters during the present study. Interestingly, the highest haemolytic activity

(low EC50) was associated with lower salinities and higher nutrient concentrations. These results are in accordance with previous studies regarding the negative correlation between salinity increase and toxin production by H. akashiwo ( Haque & Onoue 2002) and F. japonica ( de Boer et al. 2004). On the other hand, the correlation of haemolytic activity of Heterosigma blooms with nutrient concentrations contrasts with the results of many studies stating that toxin production is induced by nutrient limitation in dinoflagellates ( Anderson et al., 1990 and Simonsen et al., 1995), H. akashiwo ( Bruyant et al. 2005) and prymnesiophytes ( Johansson and Granéli, 1999a and Johansson and Granéli, 1999b). However, our results coincide with those obtained by de Boer et al.

Although we deliberately excluded those with overt chronic infections, we must underline that we did not undertake exhaustive screening for chronic viral infections, a factor that can

have a substantial impact upon the immune profile of the elderly. Further study is also needed to examine how far the associations with psychobiological variables are causal, how easily psychological health can be enhanced, and whether this will indeed have a favourable impact upon immune function. Although elderly women show some univariate correlations between fitness markers and such characteristics of an aging immune system as alterations in T cell activation markers, memory cell counts, and CD56+ cell counts, stronger learn more correlations

are seen relative to psychobiologic variables (depression, fatigue and quality of life). Longitudinal studies are recommended to examine how far the adverse psychological concomitants of aging can be reversed, and whether this may offer a helpful approach to the treatment of immuno-senescence. This study was supported by a Grant from Sao Paulo Research Foundation (FAPESP) (2001/14976-2). “
“Cervical spondylosis is a common degenerative disease that buy SP600125 causes several types of motor and sensory dysfunction. Routine clinical magnetic resonance (MR) imaging (for example, T2-weighted imaging) to evaluate pathological changes in this disease is of limited use because the correlation between the MR findings and clinical symptoms is weak [1]. Diffusion tensor imaging (DTI) has been added to conventional MR imaging in many investigations of the spinal cord to evaluate microstructural changes [2]. Changes in DTI signals depend on the diffusivity of water molecules in a particular environment. DTI-derived quantitative metrics such as the fractional anisotropy

(FA) and apparent diffusion coefficient (ADC) show promise as biomarkers in evaluating the microstructural pathology of the cervical spinal cord. For example, reduced FA and increased ADC have been reported at damaged spinal cord regions regardless of whether abnormal signal intensity in the spinal cord was observed on conventional MR images [3], [4] and [5]. Tolmetin Moreover, a recently introduced extension of the DTI technique called diffusional kurtosis imaging (DKI) [6] and [7] has shown greater promise than DTI in evaluating the microstructure and pathologic condition of neuronal tissue [8], [9], [10], [11], [12], [13] and [14], especially gray matter [15] and [16]. For evaluation of the spinal cord, DKI can provide a more comprehensive characterization of lesions and changes of white or gray matter in patients with multiple sclerosis [17]. Furthermore, as noted in a recent study [18], the mean diffusional kurtosis (MK) can provide additional information on the spinal cord in patients with cervical spondylosis.

Both samples were loaded in a Phenomenex C18 column (Jupiter 5 μ, 4 × 150 mm, California, USA) in a two-solvent system: (A)

trifluoroacetic acid (TFA)/H2O (1:1000) and (B) TFA/Acetonitrile (ACN)/H2O (1:900:100). The column was eluted at a flow rate of 1 mL/min with a 10–80% gradient of solvent B over 40 min. The HPLC column eluates were monitored by their absorbance at 214 nm. The peptides eluted were analyzed on a MALDI-ToF/PRO instrument (G&E Healthcare – Sweden). Samples were mixed 1:1 (v: v) with a supersaturated solution matrix for peptides (α-cyano 4-hydroxycinnamic acid in 50% acetonitrile containing 0.1% TFA), deposited on the sampling plate (0.4–0.8 l) and dried. The spectrometer was operated in reflectron mode and P14R ([M + H+] + 1533.85) and angiotensin II ([M + H+] + 1046.54)

(Sigma, St. Louis, MO) were used as external calibrants. SDS-PAGE was carried out according to the method of Laemmli (1970). Sting selleck venom, skin mucus and protein fractions (10 μg) of C. spixii were analyzed by SDS-PAGE JAK inhibition 4–20% acrylamide gradient under reducing conditions. Prior to electrophoresis, the samples were mixed 1:1 (v/v) with sample buffer. The gel was stained with the Silver method. For protein deglycosylation under denaturing conditions, toxin samples (20 μg) were incubated in 10% SDS for 1 min at 95 °C. After adding 0.02 M sodium phosphate buffer, 0.08% sodium azide, 0.01 M EDTA, 2% Triton X-100, pH 7.0, incubation was prolonged for 2 min at 95 °C. After cooling, 1 U of N-glycosidase F (Roche, Mannheim, Germany) was added, and the mixture was incubated for 1 h at 37 °C. The deglycosylation profiles were evaluated by SDS-PAGE as described above. The protein Fv6 was reduced and alkylated with 4-vinyl pyridine as described (Wilson and Yuan,

1989). One milligram-aliquots of Fv6 were dissolved in 1 ml of 0.1 M Tris–HCl (pH 8.6), 6 M guanidine-HCl. After addition of 30 μL β-mercaptoethanol the samples were incubated first at 50 °C for 4 h under nitrogen, then after addition of 40 μL of 4-vinyl pyridine, in the dark at 37 °C for 2 h and subsequently desalted on a PD-minitrap G25 column. The S-pyridylethylated proteins were cleaved with 2% (w/w) chymotrypsin at 37 °C for 3 h. The cleavage products were separated on a Vydac C18 small pore column (4.6 × 250 mm) Fossariinae in a linear gradient of 0–50% acetonitrile in 0.1% aqueous TFA and sequenced using a Shimadzu PPSQ-21A protein sequencer. The partial primary structure of Fv6 was compared with the sequences of other related proteins in the SWISS-PROT/TREMBL data bases using the FASTA 3 and BLAST programs. The dynamics of alterations in the microcirculatory network were determined using intravital microscopy by transillumination of mice cremaster muscle after subcutaneous application of 10 μg of all fractions, sting venom or skin mucus of C. spixii dissolved in 20 μL of sterile saline. Administration of the same amount of sterile saline was used as control.